Assigning rsID
GWASLab uses a two-step strategy (both steps are optional) to assign rsIDs to variants in your summary statistics.
-
Step 1 (TSV annotation): For quick annotation, GWASLab iterates over a SNPID-rsID table and assigns rsID by joining on SNPID (CHR:POS:REF:ALT) with sumstats. GWASLab provides curated tables (1KG autosome variants).
-
Step 2 (VCF annotation): For full annotation, GWASLab will query a large reference VCF file (dbSNP for example, >20GB) by CHR, POS, NEA, EA. It will assign the ID in VCF file to sumstats if the CHR, POS and EA/NEA match.
New in v4.0.0
The rsID assignment process has been optimized for better performance and includes improved error handling. The function now supports better STATUS code filtering to ensure only properly standardized variants receive rsID assignments.
Quick Start
# 1. Download reference data (one-time setup)
gl.download_ref("1kg_dbsnp151_hg19_auto")
# 2. Load and prepare your sumstats
mysumstats = gl.Sumstats("your_sumstats.txt.gz", ...)
mysumstats.basic_check() # Always run this first!
# 3. Assign rsIDs (simple case)
mysumstats.assign_rsid(
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto")
)
Reference Data
Before assigning rsIDs, you need reference data. GWASLab supports two types:
SNPID-rsID Table (Recommended for Common Variants)
GWASLab provides curated tables containing ~80M 1KG variants that can be downloaded automatically:
- hg19 (GRCh37):
gl.download_ref("1kg_dbsnp151_hg19_auto") - hg38 (GRCh38):
gl.download_ref("1kg_dbsnp151_hg38_auto")
1kg_dbsnp151_hg19_auto format
~/.gwaslab$ zcat 1kg_dbsnp151_hg19_auto.txt.gz |head
**SNPID** **rsID** **CHR** **POS** **NEA** **EA**
1:10177:A:AC rs367896724 1 10177 A AC
1:10235:T:TA rs540431307 1 10235 T TA
1:10352:T:TA rs555500075 1 10352 T TA
1:10505:A:T rs548419688 1 10505 A T
1:10511:G:A rs534229142 1 10511 G A
1:10539:C:A rs537182016 1 10539 C A
1:10542:C:T rs572818783 1 10542 C T
1:10579:C:A rs538322974 1 10579 C A
1:10616:CCGCCGTTGCAAAGGCGCGCCG:C rs376342519 1 10616 CCGCCGTTGCAAAGGCGCGCCG C
VCF/BCF Files (For Rare Variants)
For comprehensive annotation including rare variants, you can download dbSNP VCF files:
hg19 (GRCh37) - As of 20240205: - VCF: https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.25.gz - Index (tbi): https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.25.gz.tbi
hg38 (GRCh38) - As of 20240205: - VCF: https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.40.gz - Index (tbi): https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.40.gz.tbi
VCF file from dbSNP
zcat GCF_000001405.25.vcf.gz | head -100 | tail -10
NC_000001.10 10059 rs1570391745 C G . . RS=1570391745;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9997,0.0003425|dbGaP_PopFreq:1,0
NC_000001.10 10060 rs1639544146 C CT . . RS=1639544146;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10 10060 rs1639544159 CT C . . RS=1639544159;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=DEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10 10063 rs1010989343 A C,G . . RS=1010989343;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9928,0.004112,0.003084|Siberian:0.5,0.5,.|dbGaP_PopFreq:1,.,0
NC_000001.10 10067 rs1489251879 T TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC . . RS=1489251879;dbSNPBuildID=151;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=GnomAD:1,1.789e-05
NC_000001.10 10067 rs1639545042 T C . . RS=1639545042;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10 10067 rs1639545104 TA T . . RS=1639545104;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10 10068 rs1639545079 A T . . RS=1639545079;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10 10069 rs1570391755 A C,G . . RS=1570391755;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9966,.,0.003425|dbGaP_PopFreq:1,0,0
NC_000001.10 10069 rs1639545200 A AC . . RS=1639545200;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
Methods Overview
GWASLab provides two methods for assigning rsIDs:
| Method | Best For | Reference Files | Processing Mode |
|---|---|---|---|
.assign_rsid() |
Small to medium datasets (< 1M variants) | TSV and/or VCF/BCF | Per-variant/chunk lookup |
.assign_rsid2() |
Large datasets (millions of variants) | VCF/BCF files | Sweep mode (one-pass extraction) |
Sweep Mode vs Standard Mode
Sweep Mode (.assign_rsid2()):
- Extracts all needed variants from VCF/BCF in one pass using bcftools
- Creates a lookup table (TSV) that can be reused
- Faster for large datasets (millions of variants)
- Better for large reference VCF/BCF files (e.g., full dbSNP)
- Reduces I/O operations significantly
- Requires bcftools to be installed
Standard Mode (.assign_rsid()):
- Uses per-variant or per-chunk tabix queries
- Good for small to medium datasets (< 1 million variants)
- Better parallelization across CPU cores
- Lower memory usage
- Works with both TSV and VCF/BCF files
gwaslab 4.2.0–4.2.1: VCF assign_rsid could attach the wrong rsID
In 4.2.0 and 4.2.1, .assign_rsid(ref_rsid_vcf=..., threads>1) could write VCF-derived rsIDs onto the wrong variants when at least 10,000 rsIDs were still missing after the TSV step (GitHub #225). Chromosome and position in the sumstats stayed correct; only the rsID column was permuted. TSV-only annotation and .assign_rsid2() were not affected. Re-run rsID assignment on any 4.2.0/4.2.1 outputs produced with ref_rsid_vcf and threads>1.
VCF tabix/CSI indexes can silently skip variants
A .tbi or .csi not built from the local VCF/BCF can skip variants. Rebuild with bcftools index -t -f ref.vcf.gz.
GWASLab queries -r CHR:minPOS-maxPOS and warns when:
- a chromosome lookup (
n_targets > 0) returns no records, or the first returned POS is after the smallest target POS and > 5% of that chromosome’s targets sit before it - after VCF/sweep fill, among chromosomes with ≥ 500 eligible variants (need ≥ 5 such chromosomes), a chromosome’s fill rate is ≥ 0.15 below the median
Prerequisites
- Always run
.basic_check()first to ensure proper standardization and normalization - After
infer_strand()/flip_allele_stats(), rebuild SNPID withfix_id(fixid=True, overwrite=True)before TSV.assign_rsid()(or use.harmonize(), which does this). TSV matching is by SNPID (CHR:POS:NEA:EA), not by checking that the rsID’s chromosome matches the row. - For sweep mode (
.assign_rsid2()), bcftools must be installed and in your PATH - For VCF files, tabix/csi indexing is recommended for optimal performance
Method 1: .assign_rsid() - Standard Mode
Basic Usage
mysumstats.basic_check()
mysumstats.assign_rsid(
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto"),
ref_rsid_vcf="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
threads=2
)
Parameters
| Parameter | DataType | Description | Default |
|---|---|---|---|
ref_rsid_tsv |
string |
TSV file path for annotation of commonly used variants using SNPID (like 1:725932:G:A) as key. This is the first step and is faster for common variants. | None |
ref_rsid_vcf |
string |
VCF/BCF file path for annotation of variants with rsID not assigned. .tbi/.csi file is required for indexed VCF files. This is the second step for rare variants not in the TSV file. | None |
threads |
int |
Number of threads to use for parallel processing. More threads can speed up processing for large VCF files. | 1 |
overwrite |
string |
Overwrite mode for rsID assignment. Options: "all", "invalid", or "empty". See Overwrite Modes for details. |
"empty" |
chunksize |
int |
Size of chunks for processing large reference TSV files. Larger chunks use more memory but may be faster. | 5000000 |
Method 2: .assign_rsid2() - Sweep Mode
Basic Usage
mysumstats.basic_check()
mysumstats.assign_rsid2(
vcf_path="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
threads=6,
overwrite="empty"
)
Parameters
| Parameter | DataType | Description | Default |
|---|---|---|---|
path |
string |
Path to reference file (VCF/BCF or TSV). If both path and vcf_path/tsv_path are provided, vcf_path takes precedence, then path, then tsv_path. |
None |
vcf_path |
string |
VCF/BCF file path. Overrides path and tsv_path. For sweep mode, this is the recommended way to specify VCF/BCF files. |
None |
tsv_path |
string |
Precomputed lookup TSV file path. If provided, will use this directly instead of extracting from VCF. | None |
lookup_path |
string |
Path to save/load the extracted lookup table. If the file exists and is valid, it will be reused. Useful for caching lookup tables between runs. | None |
threads |
int |
Number of threads for bcftools operations and parallel processing. More threads can significantly speed up lookup table extraction. | 6 |
overwrite |
string |
Overwrite mode for rsID assignment. Options: "all", "invalid", or "empty". See Overwrite Modes for details. |
"empty" |
convert_to_bcf |
bool |
If True, convert VCF to BCF before processing. BCF format is more efficient for large files. | False |
strip_info |
bool |
If True, strip INFO fields when converting VCF to BCF. Reduces file size and speeds up processing. | True |
Sweep Mode Requirements
- bcftools must be installed and available in your PATH
- For VCF files, tabix/csi indexing is recommended for optimal performance
- Sweep mode creates temporary lookup TSV files that can be cached using
lookup_path
Verify bcftools installation:
Example output:
Chromosome Dictionary (Deprecated)
Automatic Chromosome Conversion
You no longer need to manually specify chromosome dictionaries! The ChromosomeMapper (accessed via mysumstats.mapper) automatically detects and converts chromosome formats between sumstats and reference files. This includes handling NCBI RefSeq notation (NC_000001.10, etc.) used in dbSNP VCF files.
The functions below are still available for advanced use cases, but are not needed for normal assign_rsid() usage:
# For hg19 (GRCh37) - available but not needed
gl.get_number_to_NC(build="19")
# {1: 'NC_000001.10', 2: 'NC_000002.11', 3: 'NC_000003.11', ...}
# For hg38 (GRCh38) - available but not needed
gl.get_number_to_NC(build="38")
# {1: 'NC_000001.11', 2: 'NC_000002.12', 3: 'NC_000003.12', ...}
These functions map chromosome numbers (1-25) to RefSeq chromosome names, but ChromosomeMapper handles this conversion automatically.
Overwrite Modes
The overwrite parameter controls which rsID values already on the object may be replaced. Only STATUS-eligible variants are considered (digit 4 = 0, digit 5 = 0–4).
"empty"(default): Only assign rsID for variants with missing/NA rsID values. This is the safest option and preserves existing rsID assignments."invalid": Assign rsID for variants with invalid rsID format (not matching the patternrs[0-9]+). Useful for fixing incorrectly formatted rsIDs."all": Clear eligible rsIDs first, then fill from the reference(s). Use with caution as this will replace existing rsID assignments.
When both ref_rsid_tsv and ref_rsid_vcf are passed to .assign_rsid() or .harmonize() (including sweep_mode=True), overwrite is applied once, then assignment is always TSV first, VCF for remaining empty eligible variants — including overwrite="all". Overlapping sites keep the TSV rsID. Omit the TSV if you want every eligible rsID from the dbSNP VCF.
Standalone .assign_rsid2(overwrite=...) is VCF/lookup-only and still applies overwrite to that single source. After a separate TSV .assign_rsid() call, use .assign_rsid2(..., overwrite="empty") for fallback; "all" on the second call replaces TSV rsIDs.
STATUS Code Filtering
Only variants with proper STATUS codes (digit 4 = 0, digit 5 = 0-4) are eligible for rsID assignment. This ensures that only standardized and normalized variants receive rsID assignments. Run .basic_check() first to ensure proper STATUS codes.
Examples
Example 1: Basic rsID Assignment with TSV File
# Download reference **SNPID**-**rsID** table first
gl.download_ref("1kg_dbsnp151_hg19_auto")
# Load sumstats
mysumstats = gl.Sumstats("t2d_bbj.txt.gz",
snpid="SNP",
chrom="CHR",
pos="POS",
ea="ALT",
nea="REF",
neaf="Frq",
beta="BETA",
se="SE",
p="P",
direction="Dir",
n="N")
# Run basic_check first to standardize and normalize
mysumstats.basic_check()
# If your **SNPID** is like 1:725932_G_A, you can use fix_id to fix the separator
mysumstats.fix_id(fixsep=True)
# rsID annotation using TSV file (fast, covers common variants)
mysumstats.assign_rsid(
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto"),
threads=2
)


Example 2: Complete rsID Assignment with Both TSV and VCF Files
# rsID annotation using both TSV and VCF files
# This maximizes annotation coverage
mysumstats.assign_rsid(
threads=2,
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto"),
ref_rsid_vcf="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
overwrite="empty" # apply to existing rsIDs, then TSV then VCF fill remaining
)
The log output shows the annotation process:
Start to assign rsID using reference file...
-Current Dataframe shape : 10000 x 12
-SNPID-rsID text file: /home/yunye/.gwaslab/1kg_dbsnp151_hg19_auto.txt.gz
-10000 rsID could be possibly fixed...
-Setting block size: 5000000
-Loading block: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
-rsID Annotation for 58 need to be fixed!
-Annotated 9942 rsID successfully!
Start to assign rsID using reference file...
-Current Dataframe shape : 10000 x 13
-CPU Cores to use : 2
-Reference VCF file: /path/to/dbsnp/GCF_000001405.25.vcf.gz
-Assigning rsID based on CHR:POS and REF:ALT/ALT:REF...
-rsID Annotation for 1 need to be fixed!
-Annotated 57 rsID successfully!
As you can see, the SNPID-rsID table (1kg_dbsnp151_hg19_auto) annotated 9942 rsIDs, and the large reference VCF file (from dbSNP) annotated an additional 57 rare rsIDs that were not in the TSV file.

Example 3: Using Overwrite Modes
# Only fill missing rsIDs (default, safest)
mysumstats.assign_rsid(
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto"),
overwrite="empty"
)
# Fix invalid **rsID** formats (e.g., "rs123" -> "rs123456")
mysumstats.assign_rsid(
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto"),
overwrite="invalid"
)
# Overwrite all rsIDs (use with caution!)
mysumstats.assign_rsid(
ref_rsid_tsv=gl.get_path("1kg_dbsnp151_hg19_auto"),
overwrite="all"
)
Example 4: Using .assign_rsid2() with Sweep Mode
# For large datasets with VCF/BCF files, use sweep mode
mysumstats.basic_check()
# Option 1: Using vcf_path (recommended)
mysumstats.assign_rsid2(
vcf_path="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
threads=8,
overwrite="empty"
)
# Option 2: Using path parameter
mysumstats.assign_rsid2(
path="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
threads=8
)
# Option 3: Using pre-computed lookup table (fastest for repeated runs)
mysumstats.assign_rsid2(
tsv_path="/path/to/cached_lookup.tsv.gz",
overwrite="empty"
)
# Option 4: Save lookup table for future use
mysumstats.assign_rsid2(
vcf_path="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
lookup_path="/path/to/cached_lookup.tsv.gz", # Save for reuse
threads=8
)
Example 5: Using .assign_rsid2() with BCF Conversion
# Convert VCF to BCF first for better performance
mysumstats.basic_check()
mysumstats.assign_rsid2(
vcf_path="/path/to/dbsnp/GCF_000001405.25.vcf.gz",
convert_to_bcf=True, # Convert to BCF format
strip_info=True, # Strip INFO fields to reduce size
threads=8
)
Performance Tips
- Use TSV first: The TSV file is much faster and covers most common variants. Only use VCF for rare variants.
- Choose the right method:
- Use
.assign_rsid()for small to medium datasets (< 1 million variants) - Use
.assign_rsid2()(sweep mode) for large datasets (millions of variants) with VCF/BCF files - Parallel processing: Increase
threadsfor faster processing, especially with large VCF files. Sweep mode benefits significantly from more threads. - Indexed VCF files: Ensure your VCF file has a
.tbi(tabix) or.csi(csi) index built from the same local VCF. A mismatched or incomplete index (including some separately downloaded indexes) can skip variants; rebuild withbcftools index -t -f <vcf>if whole-chromosome queries start mid-chromosome. - Chunk size: For
.assign_rsid(), adjustchunksizebased on available memory. Larger chunks may be faster but use more memory. - Cache lookup tables: When using
.assign_rsid2(), save the lookup table usinglookup_pathto reuse it in subsequent runs. - BCF format: For very large VCF files, consider using
convert_to_bcf=Trueto convert to BCF format, which is more efficient.
Important Notes
- Always run
.basic_check()before assigning rsIDs to ensure proper standardization and normalization - Rebuild SNPID after allele flips if you use
ref_rsid_tsv(see warning above) - Both functions only assign rsIDs to variants with proper STATUS codes (standardized and normalized)
- For VCF files, tabix/csi indexing is highly recommended for performance
- The TSV file approach is much faster and should be used first for common variants
- Sweep mode (
.assign_rsid2()) requires bcftools - ensure it's installed and in your PATH - Sweep mode creates temporary lookup tables that can be cached and reused using
lookup_path - For very large datasets, sweep mode can be significantly faster than standard mode
- Chromosome conversion is handled automatically: The
ChromosomeMapper(accessed viamysumstats.mapper) automatically detects and converts chromosome formats between sumstats and reference files. No manualchr_dictparameter is needed.