Assigning rsID
GWASLab uses a two-step strategy (both steps are optional).
- For quick annotation, GWASLab iterates over a SNPID-rsID table and assigns rsID by joining on SNPID (CHR:POS:REF:ALT) with sumstats. GWASLab provides a curated table (1KG autosome variants).
- For full annotation, GWASLab will query a large reference VCF file (dbSNP for example, >20GB ) by CHR, POS, NEA, EA. It will assign the ID in VCF file to sumstats if the CHR, POS and EN/NEA match.
Reference data
SNPID-rsID table
GWASLab provides a download function gl.download_ref() and two curated tables which contains ~80M 1KG variants:
- hg19:- gl.download_ref("1kg_dbsnp151_hg19_auto")
- hg38:- gl.download_ref("1kg_dbsnp151_hg38_auto")
VCF file
You can download this from dbSNP:
hg19 (As of 20240205)
- vcf:https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.25.gz
- tbi:https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.25.gz.tbi
hg38 (As of 20240205)
- vcf:https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.40.gz
- tbi:https://ftp.ncbi.nih.gov/snp/latest_release/VCF/GCF_000001405.40.gz.tbi
1kg_dbsnp151_hg19_auto
~/.gwaslab$ zcat 1kg_dbsnp151_hg19_auto.txt.gz |head
SNPID   rsID    CHR     POS     NEA     EA
1:10177:A:AC    rs367896724     1       10177   A       AC
1:10235:T:TA    rs540431307     1       10235   T       TA
1:10352:T:TA    rs555500075     1       10352   T       TA
1:10505:A:T     rs548419688     1       10505   A       T
1:10511:G:A     rs534229142     1       10511   G       A
1:10539:C:A     rs537182016     1       10539   C       A
1:10542:C:T     rs572818783     1       10542   C       T
1:10579:C:A     rs538322974     1       10579   C       A
1:10616:CCGCCGTTGCAAAGGCGCGCCG:C        rs376342519     1       10616   CCGCCGTTGCAAAGGCGCGCCG  C
VCF file form dbSNP
 zcat GCF_000001405.25.vcf.gz | head -100 | tail -10
NC_000001.10    10059   rs1570391745    C       G       .       .       RS=1570391745;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9997,0.0003425|dbGaP_PopFreq:1,0
NC_000001.10    10060   rs1639544146    C       CT      .       .       RS=1639544146;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10    10060   rs1639544159    CT      C       .       .       RS=1639544159;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=DEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10    10063   rs1010989343    A       C,G     .       .       RS=1010989343;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9928,0.004112,0.003084|Siberian:0.5,0.5,.|dbGaP_PopFreq:1,.,0
NC_000001.10    10067   rs1489251879    T       TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC      .       .       RS=1489251879;dbSNPBuildID=151;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=GnomAD:1,1.789e-05
NC_000001.10    10067   rs1639545042    T       C       .       .       RS=1639545042;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10    10067   rs1639545104    TA      T       .       .       RS=1639545104;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10    10068   rs1639545079    A       T       .       .       RS=1639545079;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=dbGaP_PopFreq:1,0
NC_000001.10    10069   rs1570391755    A       C,G     .       .       RS=1570391755;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9966,.,0.003425|dbGaP_PopFreq:1,0,0
NC_000001.10    10069   rs1639545200    A       AC      .       .       RS=1639545200;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL;R5;GNO;FREQ=dbGaP_PopFreq:1,0
.assign_rsid()
mysumstats.basic_check()
mysumstats.assign_rsid( 
                        ref_rsid_tsv = gl.get_path("1kg_dbsnp151_hg19_auto"),
                        ref_rsid_vcf = "/home/yunye/mydata/d_disk/dbsnp/GCF_000001405.25.vcf.gz",
                        chr_dict = gl.get_number_to_NC(build="19"),
                        n_cores = 2)
Info
Please always run .basic_check() first. This will convert the data to right data type in most cases, and standardize and normalize the sumstats.
Options
| .assign_rsid()options | DataType | Description | Default | 
|---|---|---|---|
| ref_rsid_tsv | string | TSV file path for annotation of commonly used variants using SNPID (like 1:725932:G:A) as key. | - | 
| ref_rsid_vcf | string | VCF/BCF file path for annotation of variants with rsID not assigned. .tbi/.csi file is required. | - | 
| chr_dict | dict | a dictionary for converting 1-25 to CHR in the vcf files. For example, the notation in dbSNP vcf file is based on RefSeq (like NC_000001.10). gwaslabprovides built-in conversion dictionaries.gl.get_number_to_NC(build="19")andgl.get_number_to_NC(build="19") | - | 
| n_cores | int | number of cores to use. | 1 | 
Conversion for RefSeq sequence
gl.get_number_to_NC(build="19")
{1: 'NC_000001.10',2: 'NC_000002.11',3: 'NC_000003.11', 4: 'NC_000004.11', 5: 'NC_000005.9', 6: 'NC_000006.11', 7: 'NC_000007.13', 8: 'NC_000008.10', 9: 'NC_000009.11', 10: 'NC_000010.10', 11: 'NC_000011.9', 12: 'NC_000012.11', 13: 'NC_000013.10', 14: 'NC_000014.8', 15: 'NC_000015.9', 16: 'NC_000016.9', 17: 'NC_000017.10', 18: 'NC_000018.9', 19: 'NC_000019.9', 20: 'NC_000020.10', 21: 'NC_000021.8', 22: 'NC_000022.10', 23: 'NC_000023.10', 24: 'NC_000024.9', 25: 'NC_012920.1'}
gl.get_number_to_NC(build="19")
{1: 'NC_000001.11',2: 'NC_000002.12',3: 'NC_000003.12',4: 'NC_000004.12',5: 'NC_000005.10',6: 'NC_000006.12',7: 'NC_000007.14',8: 'NC_000008.11',9: 'NC_000009.12',10: 'NC_000010.11',11: 'NC_000011.10',12: 'NC_000012.12',13: 'NC_000013.11',14: 'NC_000014.9',15: 'NC_000015.10',16: 'NC_000016.10',17: 'NC_000017.11',18: 'NC_000018.10',19: 'NC_000019.10',20: 'NC_000020.11',21: 'NC_000021.9',22: 'NC_000022.11',23: 'NC_000023.11',24: 'NC_000024.1',25: 'NC_012920.1'}
Examples
Example
# download ref SNPID-rsID table first
gl.download_ref("1kg_dbsnp151_hg19_auto") 
# if you want to annotate as much as possible. Please download the very large dbSNP vcf file.
mysumstats = gl.Sumstats("t2d_bbj.txt.gz",
             snpid="SNP",
             chrom="CHR",
             pos="POS",
             ea="ALT",
             nea="REF",
             neaf="Frq",
             beta="BETA",
             se="SE",
             p="P",
             direction="Dir",
             n="N",
             nrows=10000)
# run basic_check first
mysumstats.basic_check() 

# if you SNPID is like 1:725932_G_A , you can use fix_id to fix the separator.
mysumstats.fix_id(fixsep=True)

# rsID annotation
mysumstats.assign_rsid( n_cores = 2,
                        ref_rsid_tsv = gl.get_path("1kg_dbsnp151_hg19_auto"),
                        ref_rsid_vcf ="/home/yunye/mydata/d_disk/dbsnp/GCF_000001405.25.vcf.gz",
                        chr_dict = gl.get_number_to_NC(build="19"))
Wed Jan 11 20:05:38 2023 Start to annotate rsID based on chromosome and position information...
Wed Jan 11 20:05:38 2023  -Current Dataframe shape : 10000  x  12
Wed Jan 11 20:05:38 2023  -SNPID-rsID text file: /home/yunye/.gwaslab/1kg_dbsnp151_hg19_auto.txt.gz
Wed Jan 11 20:05:38 2023  -10000 rsID could be possibly fixed...
Wed Jan 11 20:05:38 2023  -Setting block size:  5000000
Wed Jan 11 20:05:38 2023  -Loading block: 0   1   2   3   4   5   6   7   8   9   10   11   12   13   14   15   
Wed Jan 11 20:10:16 2023  -rsID Annotation for 58 need to be fixed!
Wed Jan 11 20:10:16 2023  -Annotated 9942 rsID successfully!
Wed Jan 11 20:10:16 2023 Start to assign rsID using vcf...
Wed Jan 11 20:10:16 2023  -Current Dataframe shape : 10000  x  13
Wed Jan 11 20:10:16 2023  -CPU Cores to use : 2
Wed Jan 11 20:10:16 2023  -Reference VCF file: /home/yunye/mydata/d_disk/dbsnp/GCF_000001405.25.vcf.gz
Wed Jan 11 20:10:16 2023  -Assigning rsID based on chr:pos and ref:alt/alt:ref...
Wed Jan 11 20:10:17 2023  -rsID Annotation for 1 need to be fixed!
Wed Jan 11 20:10:17 2023  -Annotated 57 rsID successfully!
As you can see, SNPID-rsID (1kg_dbsnp151_hg19_auto) annotated 9942 rsID and the large reference VCF file (from dbSNP) annotated additonal 57 rare rsID.
